pcdna3 apex2 nes (Addgene inc)
Addgene inc is a verified supplier 
95
Structured Review
Addgene inc
pcdna3 apex2 nes
Pcdna3 Apex2 Nes, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 114 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcdna3+apex2+nes/pcDNA3+APEX2-NES+(Plasmid+%2349386)/pm41807954-183-1-3
Average 95 stars, based on 114 article reviews
Pcdna3 Apex2 Nes, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 114 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcdna3+apex2+nes/pcDNA3+APEX2-NES+(Plasmid+%2349386)/pm41807954-183-1-3
Average 95 stars, based on 114 article reviews
pcdna3 apex2 nes - by Bioz Stars,
2026-10
95/100 stars
Images
Related Articles
other:Article Title: The Kinase CK1α coordinates Initiation and Termination of the cGAS-STING Pathway Article Snippet: nLC-MS/MS analyses were performed on a nanoElute 2 nanoflow system coupled to a TIMS-TOF Pro 2 mass spectrometer (Bruker Daltonik GmbH, Bremen, Germany). Plasmid Preparation:Article Title: Kremen1 dependence receptor induces SEC24C and ATG9A-dependent cell death. Article Snippet: We cloned the Kremen1 sequence into the inducible Sleeping Beauty transposon system into the Psbtet backone (Addgene #60495 by infusion cloning (In-Fusion HD Cloning Kit, Takara bio 639649). .. The Article Title: Mechanosensitive interactions between Jag1 and Myo1c control Jag1 trafficking in endothelial cells Article Snippet: .. As control plasmid for the proximity labeling we used an APEX2 domain coupled to a nuclear export signal for cytoplasmic labeling. Article Title: Ribosome-binding protein 1 maintains peroxisome biogenesis. Article Snippet: .. A FLAG–APEX2 fragment was amplified from Article Title: A proximity labeling approach to identify proteins that associate with synaptonemal complex components in Drosophila melanogaster females Article Snippet: .. APEX2 was PCR amplified from Article Title: Mechanosensitive interactions between Jag1 and Myo1c control Jag1 trafficking in endothelial cells Article Snippet: To target HUVEC, a lentiviral variant without mKO2, due to size restrictions, was made by PCRing JAG1-APEX2 with the primers FW:TATTATCTAGATTATTTGTCATCATCGTCCTTATAATCGGCG and RV:CGAATGGAGTACATCGTAGGGGATCC, and cloned with XbaI and BamhI into pENTR1a (addgene #19364), and subsequently transferred to pLenti-DEST (Addgene #19068) using gateway recombination (LR-clonase 2). .. As control plasmid for the proximity labeling we used an APEX2 domain coupled to a nuclear export signal (NES) for cytoplasmic labeling. Cloning:Article Title: Kremen1 dependence receptor induces SEC24C and ATG9A-dependent cell death. Article Snippet: We cloned the Kremen1 sequence into the inducible Sleeping Beauty transposon system into the Psbtet backone (Addgene #60495 by infusion cloning (In-Fusion HD Cloning Kit, Takara bio 639649). .. The Control:Article Title: Mechanosensitive interactions between Jag1 and Myo1c control Jag1 trafficking in endothelial cells Article Snippet: .. As control plasmid for the proximity labeling we used an APEX2 domain coupled to a nuclear export signal for cytoplasmic labeling. Article Title: Mechanosensitive interactions between Jag1 and Myo1c control Jag1 trafficking in endothelial cells Article Snippet: To target HUVEC, a lentiviral variant without mKO2, due to size restrictions, was made by PCRing JAG1-APEX2 with the primers FW:TATTATCTAGATTATTTGTCATCATCGTCCTTATAATCGGCG and RV:CGAATGGAGTACATCGTAGGGGATCC, and cloned with XbaI and BamhI into pENTR1a (addgene #19364), and subsequently transferred to pLenti-DEST (Addgene #19068) using gateway recombination (LR-clonase 2). .. As control plasmid for the proximity labeling we used an APEX2 domain coupled to a nuclear export signal (NES) for cytoplasmic labeling. Labeling:Article Title: Mechanosensitive interactions between Jag1 and Myo1c control Jag1 trafficking in endothelial cells Article Snippet: .. As control plasmid for the proximity labeling we used an APEX2 domain coupled to a nuclear export signal for cytoplasmic labeling. Article Title: Mechanosensitive interactions between Jag1 and Myo1c control Jag1 trafficking in endothelial cells Article Snippet: To target HUVEC, a lentiviral variant without mKO2, due to size restrictions, was made by PCRing JAG1-APEX2 with the primers FW:TATTATCTAGATTATTTGTCATCATCGTCCTTATAATCGGCG and RV:CGAATGGAGTACATCGTAGGGGATCC, and cloned with XbaI and BamhI into pENTR1a (addgene #19364), and subsequently transferred to pLenti-DEST (Addgene #19068) using gateway recombination (LR-clonase 2). .. As control plasmid for the proximity labeling we used an APEX2 domain coupled to a nuclear export signal (NES) for cytoplasmic labeling. Construct:Article Title: Concerted remodelling of the postsynaptic spine and RNA granule by cLTP Article Snippet: Animal experimental procedures were approved by the ethics committee of the National Research Council of Spain (Approval number: B9900083). .. Lentiviral constructs pLKO-RFP-shCtrl (Addgene, 69040) and pLKO-RFP-shDbn1 containing the shRNA sequence GCAGTCTATCTTTGGTGACCA (TRCN0000090077) against the Dbn1 gene were used in knockdown experiments. pFUW-FLAG-APEX2, pFUW-FLAG-APEX2-DBN1 and pFUW-FLAG-APEX2-IGF2BP1 were used to perform accessibility and proximity assays, and derived from shRNA:Article Title: Concerted remodelling of the postsynaptic spine and RNA granule by cLTP Article Snippet: Animal experimental procedures were approved by the ethics committee of the National Research Council of Spain (Approval number: B9900083). .. Lentiviral constructs pLKO-RFP-shCtrl (Addgene, 69040) and pLKO-RFP-shDbn1 containing the shRNA sequence GCAGTCTATCTTTGGTGACCA (TRCN0000090077) against the Dbn1 gene were used in knockdown experiments. pFUW-FLAG-APEX2, pFUW-FLAG-APEX2-DBN1 and pFUW-FLAG-APEX2-IGF2BP1 were used to perform accessibility and proximity assays, and derived from Sequencing:Article Title: Concerted remodelling of the postsynaptic spine and RNA granule by cLTP Article Snippet: Animal experimental procedures were approved by the ethics committee of the National Research Council of Spain (Approval number: B9900083). .. Lentiviral constructs pLKO-RFP-shCtrl (Addgene, 69040) and pLKO-RFP-shDbn1 containing the shRNA sequence GCAGTCTATCTTTGGTGACCA (TRCN0000090077) against the Dbn1 gene were used in knockdown experiments. pFUW-FLAG-APEX2, pFUW-FLAG-APEX2-DBN1 and pFUW-FLAG-APEX2-IGF2BP1 were used to perform accessibility and proximity assays, and derived from Knockdown:Article Title: Concerted remodelling of the postsynaptic spine and RNA granule by cLTP Article Snippet: Animal experimental procedures were approved by the ethics committee of the National Research Council of Spain (Approval number: B9900083). .. Lentiviral constructs pLKO-RFP-shCtrl (Addgene, 69040) and pLKO-RFP-shDbn1 containing the shRNA sequence GCAGTCTATCTTTGGTGACCA (TRCN0000090077) against the Dbn1 gene were used in knockdown experiments. pFUW-FLAG-APEX2, pFUW-FLAG-APEX2-DBN1 and pFUW-FLAG-APEX2-IGF2BP1 were used to perform accessibility and proximity assays, and derived from Derivative Assay:Article Title: Concerted remodelling of the postsynaptic spine and RNA granule by cLTP Article Snippet: Animal experimental procedures were approved by the ethics committee of the National Research Council of Spain (Approval number: B9900083). .. Lentiviral constructs pLKO-RFP-shCtrl (Addgene, 69040) and pLKO-RFP-shDbn1 containing the shRNA sequence GCAGTCTATCTTTGGTGACCA (TRCN0000090077) against the Dbn1 gene were used in knockdown experiments. pFUW-FLAG-APEX2, pFUW-FLAG-APEX2-DBN1 and pFUW-FLAG-APEX2-IGF2BP1 were used to perform accessibility and proximity assays, and derived from Amplification:Article Title: Ribosome-binding protein 1 maintains peroxisome biogenesis. Article Snippet: .. A FLAG–APEX2 fragment was amplified from Article Title: A proximity labeling approach to identify proteins that associate with synaptonemal complex components in Drosophila melanogaster females Article Snippet: .. APEX2 was PCR amplified from Generated:Article Title: Ribosome-binding protein 1 maintains peroxisome biogenesis. Article Snippet: .. A FLAG–APEX2 fragment was amplified from Polymerase Chain Reaction:Article Title: A proximity labeling approach to identify proteins that associate with synaptonemal complex components in Drosophila melanogaster females Article Snippet: .. APEX2 was PCR amplified from |
